312

sequence

length

of

−21.5 

kcal/mol,

whereas

the

sequence

GCATGACGTAGCAGCCGTACGATAT has an energy of −2.10 kcal/mol and twice

the length of −12.40 kcal/mol.

Question 2.2

Regulatory RNA elements are found in humans, but also in other organisms such as bac­

teria. Examples of regulatory RNA elements are iron-responsive elements (IRE) and ribo­

switches. They perform regulatory functions and control transcription and translation. IRE

regulate iron metabolism in humans and animals, depending on the iron content of the cell.

Riboswitches regulate gene expression in prokaryotes. Metabolites specifically bind a

riboswitch, which leads to a conformational change of the riboswitch and thus switches

genes on or off. However, there are also other RNA elements in prokaryotes, e.g. the

6 S-RNA (general STOP signal) and the ppGpp (messenger). An important database for

RNA families is Rfam, which lists quite a few different families (best take a look).

Questions 2.3 and 2.4

Bioinformatically, it is of course also possible to find regulatory RNA motifs. Here, it is

best to combine several criteria, such as sequence, structure and folding energy, in order to

achieve a higher degree of accuracy. An IRE can be recognised by these three criteria,

among others:

• Matching consensus sequence “CAGUGN” and a C alone, without G as a partner in the

opposite strand (“bulged“),

• structure (loop stem structure, stem-loop) of two stems on top of each other, in between

is the unpaired C and

• energy (when this structural part is considered as a whole, −2.1 to −6.7 kcal/mol).

Only when all parameters are fulfilled, i.e. when all criteria for an RNA molecule are met,

should the bioinformatic motif search produce a corresponding hit.

Regulatory RNA elements can be identified using programs such as RNAAnalyzer,

Riboswitch Finder or RegRNA. Of course, a bioinformatically predicted hit should be

checked experimentally. This is the only way to be sure that the element found actually

performs a biological function.

Question 2.5

Answer C, D, E (please also look at the previous answers)

Example 2.6

1. Question: You should find three positions (CAGTGC, CAGTGA, CAGTGC)

2. Question: Answer A, C, D

The RNAAnalyzer finds an IRE at position 71 in the exercise example (you should also

find it by hand). However, it also finds a catalytic RNA.

20  Solutions to the Exercises